Subsequence

Poll without page-refresh

Article on other languages:

	del.icio.us
	Digg
	Furl
	Reddit
	Rojo
	Add to OnlyWire

In mathematics, a subsequence of some sequence is a new sequence which is formed from the original sequence by deleting some of the elements without disturbing the relative positions of the remaining elements.

Formally, suppose that X is a set and that (a_k)_{k ∈ K} is a sequence in X, where K = {1,2,3,...,n} if (a_k) is a finite sequence and K = N if (a_k) is an infinite sequence. Then, a subsequence of (a_k) is a sequence of the form $(a_{n_r})$ where (n_r) is a strictly increasing sequence in the index set K.

1 Example
2 Applications
3 Substring vs. subsequence
4 See also
5 References

Example

As an example,

< B, C, D, G >

is a subsequence of

< A, C, B, D, E, G, C, E, D, B, G >

with corresponding index sequence <3,7,9,11>.

Given two sequences X and Y, a sequence G is said to be a common subsequence of X and Y, if G is a subsequence of both X and Y. For example, if

X = < A, C, B, D, E, G, C, E, D, B, G >

and

Y = < B, E, G, C, F, E, U, B, K >

then common subsequence of X and Y could be

G = < B, E, E >

This would not be the longest common subsequence, since G only has length 3, and the common subsequence < B,E,E,B > has length 4. The longest common subsequence of X and Y is < B,E,G,C,E,B >.

Applications

Subsequences have applications to computer science, especially in the discipline of Bioinformatics, where computers are used to compare, analyze, and store DNA strands.

Take two strands of DNA, say :

ORG₁ = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
ORG₂ = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA

Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.

Substring vs. subsequence

In computer science, string is often used as a synonym for sequence, but it is important to note that substring and subsequence are not synonyms. Substrings are consecutive parts of a string, while subsequences need not be. This means that a substring of a string is always a subsequence of the string, but the opposite is not true.^[1]

References

^ Gusfield, Dan [1997] (1999). Algorithms on Strings, Trees and Sequences: Computer Science and Computational Biology. USA: Cambridge University Press, 4. ISBN 0-521-58519-8.

This article incorporates material from subsequence on PlanetMath, which is licensed under the GFDL.

Retrieved from "http://en.wikipedia.org/wiki/Subsequence"